Gene name |
SPAC824.01 |
Gene ID |
46/A08 |
Gene synonyms/obsolete |
SPAC343.19 |
Gene product |
phosphatidylinositol
4-kinase; human Wiskott-Aldridge syndrome protein interacting
protein homolog; involved in the regulation of actin
cytoskeletal organization |
Entry clone |
Cloned |
ORF length (unspliced) |
1875 |
ORF length (spliced) |
|
Entry clone length |
1875 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC824.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAATCGACATTCCATTC |
Rev primer name |
SPAC824.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAACACGTGCTAAAGACCGCA |
Amino acid length |
624 |
Molecular weight |
71.8 |
Isoelectric point (calc.) |
5.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
Golgi; vacuole
membrane; periphery at site of septum formation |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |