Gene name |
SPAC57A7.13 |
Gene ID |
46/A06 |
Gene synonyms/obsolete |
|
Gene product |
RNA-binding protein;
rrm RNA recognition motif (2); G-patch domain; zinc finger
protein; zf-C2H2 type; similar to human tumor suppressor
luca15; no apparent Sc ortholog |
Entry clone |
Cloned |
ORF length (unspliced) |
1865 |
ORF length (spliced) |
1698 |
Entry clone length |
1865 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC57A7.13.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGGATTATTATTCAGA |
Rev primer name |
SPAC57A7.13.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATAAATTATTGTTTTTATCA |
Amino acid length |
565 |
Molecular weight |
64.4 |
Isoelectric point (calc.) |
8.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LWKGLSKLEI |
Localization (YFP) |
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |