Gene name |
SPBC211.06 |
Gene ID |
45/F10 |
Gene synonyms/obsolete |
|
Gene product |
gamma tubulin complex
subunit; non-essential; GRIP domain; similar to human GPC4; no
apparent S. cerevisiae ortholog |
Entry clone |
Cloned |
ORF length (unspliced) |
1734 |
ORF length (spliced) |
|
Entry clone length |
1734 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC211.06.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTGCATGAGATTATTTT |
Rev primer name |
SPBC211.06.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATAAATTAAGCTGAACAATC |
Amino acid length |
577 |
Molecular weight |
66.7 |
Isoelectric point (calc.) |
5.2 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRLLLSKKLFL/LRKTISLLDL/LWILLGSLHL/LNSIYHELSL |
Localization (YFP) |
nucleus>>cytosol; SPB |
Comments for localization |
nuclear dots by over
expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |