| Gene name |
SPAC1039.01 |
| Gene ID |
45/F01 |
| Gene synonyms/obsolete |
|
| Gene product |
amino acid permease
family; similar to Sp SPBC15C4.04C and SPAPB24D3.02C and
SPCC74.04 and SPAC11D3.08C and SPCC584.13 and SPAC9.10 and
SPCC794.03 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1704 |
| ORF length (spliced) |
|
| Entry clone length |
1704 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC1039.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGTCTATTATGGAAAA |
| Rev primer name |
SPAC1039.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAGATCTCCTTTAATCTTA |
| Amino acid length |
567 |
| Molecular weight |
61.7 |
| Isoelectric point (calc.) |
6.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
10 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LAVSFVALMI |
| Localization (YFP) |
cytoplasmic dots
|
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |