Gene name |
SPAC22F8.07c |
Gene ID |
45/E04 |
Gene synonyms/obsolete |
|
Gene product |
Myb family; DNA
binding protein; similar to Sp SPBC1198.11c (paralog);
termination factor for RNA polymerase I; transcription factor
for RNA polymerase II |
Entry clone |
Cloned |
ORF length (unspliced) |
1662 |
ORF length (spliced) |
1491 |
Entry clone length |
1662 |
No. of intron |
4 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC22F8.07.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCAAGGAAAAAACAATTT |
Rev primer name |
SPAC22F8.07.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGCATAAATCATCGGCGTTA |
Amino acid length |
496 |
Molecular weight |
58.8 |
Isoelectric point (calc.) |
9.2 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LPKPFNNLLI |
Localization (YFP) |
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |