| Gene name |
SPBC36.03c |
| Gene ID |
45/D06 |
| Gene synonyms/obsolete |
|
| Gene product |
unknown specificity;
transporter; similar to Sp SPAC11D3.05 and SPCC794.04C and
SPCC569.05C and SPBC530.15C and SPBC36.01C and SPBC36.02C and
SPBC530.02 and SPBC947.06C; involved in amine/polyamine
transport; tandem duplication |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1617 |
| ORF length (spliced) |
|
| Entry clone length |
1617 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC36.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTATAACAATAATTCTTC |
| Rev primer name |
SPBC36.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACAAATTAACGGTATTTTTA |
| Amino acid length |
538 |
| Molecular weight |
59.1 |
| Isoelectric point (calc.) |
7.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
11 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |