| Gene name |
SPAC3C7.13c |
| Gene ID |
44/E11 |
| Gene synonyms/obsolete |
|
| Gene product |
glucose-6-phosphate
1-dehydrogenaseglucose-6-phosphate 1-dehydrogenase; involved
in pentose-phosphate shunt, oxidative branch (1st step);
involved in glutathione metabolism; involved in glucose
6-phosphate utilization; glucose-6-phosphate 1-dehydrogenase
activity; similar to Sp SPAC3C7.13C and
SPCC794.01C(2others) |
| Entry clone |
#Not cloned yet |
| ORF length (unspliced) |
1422 |
| ORF length (spliced) |
|
| Entry clone length |
1422 |
| No. of intron |
0 |
| Sequence status |
#Not cloned yet |
| Sequence results |
#Not cloned/serious
mutation |
| Comments |
|
| Polymerase used for cloning |
|
| Fwd primer name |
SPAC3C7.13.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTTACTTTTATGGTATT |
| Rev primer name |
SPAC3C7.13.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTCATGGCCTAGATGCCTT |
| Amino acid length |
473 |
| Molecular weight |
54.4 |
| Isoelectric point (calc.) |
8.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
not cloned |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
|