| Gene name |
SPAC3G9.01 |
| Gene ID |
44/D09 |
| Gene synonyms/obsolete |
|
| Gene product |
hypothetical protein;
sequence orphan |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1389 |
| ORF length (spliced) |
|
| Entry clone length |
1389 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC3G9.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTTACAAACTTTCTCT |
| Rev primer name |
SPAC3G9.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACTTTGAATGTTTTTTCGA |
| Amino acid length |
462 |
| Molecular weight |
51.5 |
| Isoelectric point (calc.) |
10.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
362/384 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
spindle microtubules;
nucleolus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle
(nucleolus>>nucleus) |
| Microscope used for
observation |
DeltaVision |