| Gene name |
SPAC3C7.12 |
| Gene ID |
44/D06 |
| Gene synonyms/obsolete |
noc1; tip1 |
| Gene product |
microtubule-associated
protein; involved in microtubule based movement; similar to
eukaryotic intermediate filament proteins; involved in actin
cytoskeletal organization; involved in cell polarity; CLIP170
like protein; CAP-Gly domain |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1386 |
| ORF length (spliced) |
|
| Entry clone length |
1386 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC3C7.12.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTTCCTCTTGGCAGTGT |
| Rev primer name |
SPAC3C7.12.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGCTTCGTCTGTGCTGCCA |
| Amino acid length |
461 |
| Molecular weight |
52.6 |
| Isoelectric point (calc.) |
4.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LEHTIEQLTI |
| Localization (YFP) |
cytosol; cytoplasmic
dots at cell tip |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (nucleus>>cytosol;
cytoplasmic dots at cell tip) |
| Microscope used for
observation |
DeltaVision |