| Gene name |
SPAC1486.02c |
| Gene ID |
44/C03 |
| Gene synonyms/obsolete |
|
| Gene product |
UBA domain; possibly
fungal specific |
| Entry clone |
Cloned in 2006
trial/#check (not sequenced before) |
| ORF length (unspliced) |
1314 |
| ORF length (spliced) |
1119 |
| Entry clone length |
1314 |
| No. of intron |
2 |
| Sequence status |
not sequenced |
| Sequence results |
#check (not
sequenced) |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC1486.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTAGCGCCAATATTGG |
| Rev primer name |
SPAC1486.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATAGTCGGCTGTTTGCTCC |
| Amino acid length |
372 |
| Molecular weight |
42.2 |
| Isoelectric point (calc.) |
8.3 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
5 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no expression clone
(needs check) |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
|