| Gene name |
SPBC2G2.10c |
| Gene ID |
43/C03 |
| Gene synonyms/obsolete |
|
| Gene product |
sequence orphan;
hypothetical protein |
| Entry clone |
Cloned |
| ORF length (unspliced) |
790 |
| ORF length (spliced) |
747 |
| Entry clone length |
790 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC2G2.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTTGAATCGTCTGATGA |
| Rev primer name |
SPBC2G2.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGGTTTGATTTGCATTGTTA |
| Amino acid length |
248 |
| Molecular weight |
27.8 |
| Isoelectric point (calc.) |
5.1 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LIPIFFIALII/LETDMYDLPI |
| Localization (YFP) |
cytoplasmic dots at
cell tip and site of septum formation |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |