| Gene name |
SPAC18G6.06 |
| Gene ID |
43/B01 |
| Gene synonyms/obsolete |
|
| Gene product |
ribonucleoprotein
(RNP) complex; processome component; involved in rRNA
processing |
| Entry clone |
Cloned |
| ORF length (unspliced) |
750 |
| ORF length (spliced) |
|
| Entry clone length |
750 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
165A:C / Mixture from
602 |
| Comments |
Mixture of 2 clones,
one of which is frameshifted from somewhere. But YFP clones
may be OK. |
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC18G6.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTTCGTCTTTTAAAAA |
| Rev primer name |
SPAC18G6.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATCGTTTTCTCTCATTCCTC |
| Amino acid length |
249 |
| Molecular weight |
29.6 |
| Isoelectric point (calc.) |
10.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
spindle microtubules;
nucleolus>>nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |