| Gene name |
SPBC21.04 |
| Gene ID |
43/A10 |
| Gene synonyms/obsolete |
sep15; med8 |
| Gene product |
RNA polymerase II
holoenzyme component; mediator complex subunit; essential;
involved in regulating RNA polymerase II activity; involved in
conjugation; involved in sporulation; involved in
septation |
| Entry clone |
Cloned |
| ORF length (unspliced) |
740 |
| ORF length (spliced) |
603 |
| Entry clone length |
740 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC21.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAAGACATATCTACCGA |
| Rev primer name |
SPBC21.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACGTTTACCTGATTTCATG |
| Amino acid length |
200 |
| Molecular weight |
23.3 |
| Isoelectric point (calc.) |
4.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |