| Gene name |
SPBC428.13c |
| Gene ID |
43/A08 |
| Gene synonyms/obsolete |
mob1 |
| Gene product |
SIN component;
involved in cytokinesis (required); involved in septation;
interacts physically with Sid2p; essential; protein kinase
regulator Mob1; maintenance of ploidy protein Mob1;
Sid2p-Mob1p kinase complex; Mob1/phocein family |
| Entry clone |
Cloned |
| ORF length (unspliced) |
738 |
| ORF length (spliced) |
633 |
| Entry clone length |
738 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC428.13.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTTGGATTTAGTAATAA |
| Rev primer name |
SPBC428.13.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAACCATGCTATCTACCAAG |
| Amino acid length |
210 |
| Molecular weight |
24.7 |
| Isoelectric point (calc.) |
7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
SPB; periphery at site
of septum formation; nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |