| Gene name |
SPCC1259.03 |
| Gene ID |
42/D06 |
| Gene synonyms/obsolete |
rpa12 |
| Gene product |
DNA-directed RNA
polymerase I subunitDNA-directed RNA polymerase activity
(A12.2 subunit); DNA-directed RNA polymerase I complex;
involved in transcription from Pol I promoter; functionally
complements Sc RPA12; non-essential: required for growth at
high temperatures |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
605 |
| ORF length (spliced) |
360 |
| Entry clone length |
605 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
321T:addition |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC1259.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGGCAATAGGGTCTTT |
| Rev primer name |
SPCC1259.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATTGTTTGTACTAAATTTA |
| Amino acid length |
119 |
| Molecular weight |
13.1 |
| Isoelectric point (calc.) |
4.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleolus>nucleus>=cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |