Gene name |
SPAC23C11.10 |
Gene ID |
42/A03 |
Gene synonyms/obsolete |
|
Gene product |
hypothetical
proteinconserved hypothetical protein; similar to D.
melanogaster CG16790; similar to M. musculus Q91W78; similar
to human Q9BQ65; no apparent Sc ortholog |
Entry clone |
Cloned directly into
pDUAL-FFH1 |
ORF length (unspliced) |
978 |
ORF length (spliced) |
798 |
Entry clone length |
978 |
No. of intron |
4 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC23C11.10.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTTTAGTATGTTATGA |
Rev primer name |
SPAC23C11.10.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTTACAAAATGGAAAGGTA |
Amino acid length |
265 |
Molecular weight |
31.5 |
Isoelectric point (calc.) |
7.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
no expression
clone |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
|