| Gene name |
SPBC336.02 |
| Gene ID |
41/H06 |
| Gene synonyms/obsolete |
dim1 |
| Gene product |
dimethylase;
dimethyladenosine transferase; 18S rRNA dimethylase;
essential; required for mitosis; interacts physically with
Lid1p; required for APC function; involved in mRNA
splicing |
| Entry clone |
Cloned |
| ORF length (unspliced) |
982 |
| ORF length (spliced) |
924 |
| Entry clone length |
982 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC336.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGAAAGATTCGGGTTAG |
| Rev primer name |
SPBC336.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGCAAAATGAACGCCAACC |
| Amino acid length |
307 |
| Molecular weight |
34.6 |
| Isoelectric point (calc.) |
9.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleolus>>nucleus; spindle microtubules |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (nucleolus>nucleus) |
| Microscope used for
observation |
Leica |