Gene name |
SPAPB1A10.04c |
Gene ID |
41/G11 |
Gene synonyms/obsolete |
cwp1 |
Gene product |
geranylgeranyltransferase type I (GGTase I), alpha
subunit; involved in the post-translational C-terminal
modification of several small GTPases, allowing their
targeting to the membrane; essential |
Entry clone |
Cloned# |
ORF length (unspliced) |
936 |
ORF length (spliced) |
885 |
Entry clone length |
936 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAPB1A10.04.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATCCCATTGATCCCGA |
Rev primer name |
SPAPB1A10.04.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGGATTGCTCCTTTGGGAC |
Amino acid length |
294 |
Molecular weight |
34.8 |
Isoelectric point (calc.) |
4.8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nuclear dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |