| Gene name |
SPBC32H8.07 |
| Gene ID |
41/G09 |
| Gene synonyms/obsolete |
git5; gpb1;
SPACTOKYO_453.20 |
| Gene product |
G-protein beta
subunit; WD repeat protein; dimerizes with Git11p;
glucose/cAMP pathway; reciprocal best hit of Sc STE4 but not
functional ortholog; no apparent Sc ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
918 |
| ORF length (spliced) |
|
| Entry clone length |
918 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC32H8.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATTCTGGGTCAAGAGT |
| Rev primer name |
SPBC32H8.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACCCTGACGAAGACCAGAGA |
| Amino acid length |
305 |
| Molecular weight |
32.8 |
| Isoelectric point (calc.) |
4.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |