| Gene name |
SPCC1322.11 |
| Gene ID |
41/E03 |
| Gene synonyms/obsolete |
rpl2302; rpl23-2 |
| Gene product |
60S ribosomal protein
L23 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
685 |
| ORF length (spliced) |
420 |
| Entry clone length |
685 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
179A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC1322.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTCGTGGACGCGGTGC |
| Rev primer name |
SPCC1322.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAACAACGGTACCAGCATTT |
| Amino acid length |
139 |
| Molecular weight |
14.8 |
| Isoelectric point (calc.) |
10.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus;
mitochondrion |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |