Gene name |
SPBC20F10.04c |
Gene ID |
41/B09 |
Gene synonyms/obsolete |
|
Gene product |
conserved
hypothetical; hypothetical protein |
Entry clone |
Cloned directly into
pDUAL-FFH1 |
ORF length (unspliced) |
912 |
ORF length (spliced) |
762 |
Entry clone length |
912 |
No. of intron |
4 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC20F10.04.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCCTCCATTGATAAACG |
Rev primer name |
SPBC20F10.04.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAATTCTAAATATAATTGAT |
Amino acid length |
253 |
Molecular weight |
29.4 |
Isoelectric point (calc.) |
10.9 |
Signal SEQ |
|
No. of transmembrane domain |
1 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
no expression
clone |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
|