| Gene name |
SPBC365.17 |
| Gene ID |
40/G09 |
| Gene synonyms/obsolete |
ccr1;
SPBC29A10.01 |
| Gene product |
NADPH-cytochrome p450
reductase; involved in ergosterol biosynthesis |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2037 |
| ORF length (spliced) |
|
| Entry clone length |
2037 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
147A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC365.17.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGACTTATGAATATGT |
| Rev primer name |
SPBC365.17.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACCAGGTATCTTCAAAAAAT |
| Amino acid length |
678 |
| Molecular weight |
76.7 |
| Isoelectric point (calc.) |
5.3 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLVIILILSL |
| Localization (YFP) |
ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |