| Gene name |
SPAC13G7.02c |
| Gene ID |
40/G05 |
| Gene synonyms/obsolete |
hsp70 |
| Gene product |
heat shock protein 70
family; similar to Sp SPCC1739.13 (paralog) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1935 |
| ORF length (spliced) |
|
| Entry clone length |
1935 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
289G:A / 1784A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC13G7.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGCAAGTCTATCGGTAT |
| Rev primer name |
SPAC13G7.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATCCACTTCTTCAACCTCA |
| Amino acid length |
644 |
| Molecular weight |
70.1 |
| Isoelectric point (calc.) |
4.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LIAGLNVLRI/LLLDVAPLSL |
| Localization (YFP) |
cytosol |
| Comments for localization |
bright signal |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |