| Gene name |
SPAC1687.15 |
| Gene ID |
40/F09 |
| Gene synonyms/obsolete |
gsk3; skp1 |
| Gene product |
serine/threonine
protein kinase; glycogen synthase kinase 3 (GSK-3) family;
involved in cytokinesis; interacts physically with Cdc14p;
involved in mitosis (progression); phosphorylated at S-335;
non-essential; deletion mutant sensitive to heat shock;
deletion mutant results in sporulation defects; overexpression
suppresses cdc14-118 cytokinesis defect; similar to Sp
gsk31 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1693 |
| ORF length (spliced) |
1164 |
| Entry clone length |
1693 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
331A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC1687.15.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATCATGGTACTAAAAG |
| Rev primer name |
SPAC1687.15.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATCAATTCGGGCACGATGA |
| Amino acid length |
387 |
| Molecular weight |
44.1 |
| Isoelectric point (calc.) |
8.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |