| Gene name |
SPBC21C3.18 |
| Gene ID |
40/F07 |
| Gene synonyms/obsolete |
spo4 |
| Gene product |
serine/threonine
protein kinase; involved in sporulation (required); involved
in spindle formation (meiotic); involved in ascospore
formation (required); essential |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1672 |
| ORF length (spliced) |
1290 |
| Entry clone length |
1672 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC21C3.18.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTTTCCATGCTATTACC |
| Rev primer name |
SPBC21C3.18.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTGCTCTACAGTTGAAGGG |
| Amino acid length |
429 |
| Molecular weight |
49.1 |
| Isoelectric point (calc.) |
6.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol=nucleus;
cytoplasmic dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |