| Gene name |
SPBC146.07 |
| Gene ID |
40/F01 |
| Gene synonyms/obsolete |
mis11; prp2 |
| Gene product |
RNA-binding protein;
involved in mRNA splicing (IGI); SR family; U2AF large subunit
(U2AF-59); rrm RNA recognition motif; SF1-U2AF(59)-U2AF(23)
complex; involved in pre-spliceosome formation; similar to
human U2AF54 |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
1554 |
| ORF length (spliced) |
|
| Entry clone length |
1554 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC146.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATTTGTCTTCCAGATT |
| Rev primer name |
SPBC146.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACCATGCATTAGCTTTATAG |
| Amino acid length |
517 |
| Molecular weight |
58.9 |
| Isoelectric point (calc.) |
7.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
74/75 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |