| Gene name |
SPBC646.14c |
| Gene ID |
40/E10 |
| Gene synonyms/obsolete |
orc5 |
| Gene product |
origin recognition
complex (subunit 5) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1461 |
| ORF length (spliced) |
1368 |
| Entry clone length |
1461 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
454T:C / 1076T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC646.14.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCATTTGTATCAGTTGGA |
| Rev primer name |
SPBC646.14.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATCCCGCCAAATAACTATCG |
| Amino acid length |
455 |
| Molecular weight |
51.7 |
| Isoelectric point (calc.) |
8.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
333 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFSQLAQLPI |
| Localization (YFP) |
nucleus |
| Comments for localization |
nuclear dots by over
expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |