| Gene name |
SPBC2D10.06 |
| Gene ID |
40/E08 |
| Gene synonyms/obsolete |
rep1; rec16 |
| Gene product |
DSC1/MBF trancription
factor complex; involved in meiotic recombination; involved in
DNA repair; zinc finger protein; zf-C2H2 type; involved in
start control point of mitotic cell cycle; no apparent
orthologs |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1419 |
| ORF length (spliced) |
|
| Entry clone length |
1419 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
285T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC2D10.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATTCTGATCGTTGTTT |
| Rev primer name |
SPBC2D10.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACCAATCACTGCAAAAACTC |
| Amino acid length |
472 |
| Molecular weight |
52.6 |
| Isoelectric point (calc.) |
6.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LQSSFGDDLDL |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |