Gene name |
SPBC2D10.06 |
Gene ID |
40/E08 |
Gene synonyms/obsolete |
rep1; rec16 |
Gene product |
DSC1/MBF trancription
factor complex; involved in meiotic recombination; involved in
DNA repair; zinc finger protein; zf-C2H2 type; involved in
start control point of mitotic cell cycle; no apparent
orthologs |
Entry clone |
Cloned |
ORF length (unspliced) |
1419 |
ORF length (spliced) |
|
Entry clone length |
1419 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
285T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC2D10.06.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATTCTGATCGTTGTTT |
Rev primer name |
SPBC2D10.06.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACCAATCACTGCAAAAACTC |
Amino acid length |
472 |
Molecular weight |
52.6 |
Isoelectric point (calc.) |
6.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LQSSFGDDLDL |
Localization (YFP) |
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |