| Gene name |
SPBC1734.02c |
| Gene ID |
40/E06 |
| Gene synonyms/obsolete |
cdc27;
SPBC337.18c |
| Gene product |
DNA polymerase (delta
subunit); involved in G2/M phase transition (required);
interacts physically with Pcn1p; recruits PCNA to the Pol
delta holoenzyme; interacts physically with Cdc1p; essential;
involved in DNA replication (required); involved in telomere
maintenance |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1408 |
| ORF length (spliced) |
1119 |
| Entry clone length |
1408 |
| No. of intron |
5 |
| Sequence status |
Finished |
| Sequence results |
6G:deletion /
7G:deletion / 8A:deletion |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC1734.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAGGAATGGAGAAACTT |
| Rev primer name |
SPBC1734.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTCTTTCCAAAAAAGGAC |
| Amino acid length |
372 |
| Molecular weight |
42.3 |
| Isoelectric point (calc.) |
5.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
294 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LVTVDNLSL |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |