| Gene name |
SPBC19C2.03 |
| Gene ID |
39/G03 |
| Gene synonyms/obsolete |
rpc10: rpb12 |
| Gene product |
DNA-directed RNA
polymerases I, II, and III 7. DNA-directed RNA polymerases (I,
II, and III subunit); abc10-alpha; involved in transcription
from Pol I promoter; involved in transcription from Pol II
promoter; involved in transcription from Pol III promoter;
DNA-directed RNA polymerase activity (function of complex);
interacts physically with Rpb1p; interacts physically with
Rpb2p |
| Entry clone |
Cloned |
| ORF length (unspliced) |
245 |
| ORF length (spliced) |
192 |
| Entry clone length |
245 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC19C2.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATCATCCAACCTCCAC |
| Rev primer name |
SPBC19C2.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGCGTGCTTCGAACTGAACC |
| Amino acid length |
63 |
| Molecular weight |
7.2 |
| Isoelectric point (calc.) |
10.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleolus>nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |