| Gene name |
SPBC1604.14c |
| Gene ID |
39/F04 |
| Gene synonyms/obsolete |
shk1; pak1 |
| Gene product |
serine-threonine
protein kinase Pak1-Shk1; serine/threonine protein kinase;
Ras1p-Scd1p-Scd2p-Cdc42p-Shk1p complex; p21-activated kinase;
effector for Cdc42p; interacts physically with Cdc42p;
interacts physically with Scd2p; required for Ras and
Cdc42p-dependent signaling cascades; involved in Ras/Cdc42
signaling module; Cdc42p/Rac interactive binding (CRIB) motif;
involved in actin cytoskeletal organization; involved in cell
polarity (required); required for proper regulation of
microtubule dynamics; essential; inhibited by skb15; involved
in cytokinesis; phosphorylates Tea1p |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1977 |
| ORF length (spliced) |
|
| Entry clone length |
1977 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC1604.14.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAAAGAGGGACTTTACA |
| Rev primer name |
SPBC1604.14.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTACCAGAATGATGTATG |
| Amino acid length |
658 |
| Molecular weight |
72.3 |
| Isoelectric point (calc.) |
10.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
periphery at cell tip
and site of septum formation; cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |