| Gene name |
SPBC6B1.01c |
| Gene ID |
39/E09 |
| Gene synonyms/obsolete |
SPBC1826.01c;
SPBC25B2.12c |
| Gene product |
probable
helicase |
| Entry clone |
Cloned |
| ORF length (unspliced) |
5862 |
| ORF length (spliced) |
|
| Entry clone length |
5862 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
1244A:G / 1417C:T /
1761A:G / 4097T:C / 5335C:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC6B1.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACAACACGCCTCGACCG |
| Rev primer name |
SPBC6B1.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGAAGCATCCTTGGGTAAA |
| Amino acid length |
1953 |
| Molecular weight |
217.6 |
| Isoelectric point (calc.) |
6.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
285 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLNDFVSQLNI/LTTHVGGLGL |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Leica |