| Gene name |
SPAC1834.08 |
| Gene ID |
39/E07 |
| Gene synonyms/obsolete |
mak1 |
| Gene product |
putative sensory
transduction histidine kinase histidine kinase; involved in
signal transduction; His-to-Asp phosphorelay; non-essential;
functions upstream of Spy1p; function overlapping with Mak2p
and Mak3p; implicated in mitotic cell cycle control;
implicated in oxidative stress response; required for the
regulation of sexual development; PAC domain protein; similar
to Sp mak2 and mak3; response regulator receiver domain |
| Entry clone |
Cloned |
| ORF length (unspliced) |
5020 |
| ORF length (spliced) |
4920 |
| Entry clone length |
5020 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
1969T:C /
3058A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC1834.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGGCCACCTGACGATCA |
| Rev primer name |
SPAC1834.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTGTGTAACTTTGATTGG |
| Amino acid length |
1639 |
| Molecular weight |
184.5 |
| Isoelectric point (calc.) |
7.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
641 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLTVINDILDL |
| Localization (YFP) |
cytoplasmic dots at
cell tip and site of septum formation; cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |