| Gene name |
SPBP35G2.10 |
| Gene ID |
39/E04 |
| Gene synonyms/obsolete |
|
| Gene product |
helicase C protein
with SNF2 domain; zinc finger protein; zf-PHD finger; SNF2
familyhelicase C-terminal domain; DEAD/DEAH box helicase;
transcriptional regulator; involved in transcriptional
regulation |
| Entry clone |
Cloned |
| ORF length (unspliced) |
4257 |
| ORF length (spliced) |
|
| Entry clone length |
4257 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBP35G2.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCAAAAGAAGATGATTC |
| Rev primer name |
SPBP35G2.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAGAGTTTTTGCTTCATTA |
| Amino acid length |
1418 |
| Molecular weight |
162.6 |
| Isoelectric point (calc.) |
7.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKGLNWLYL/LFSQFIQQLDI |
| Localization (YFP) |
SPB?; nuclear dots;
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |