| Gene name |
SPAC9G1.02 |
| Gene ID |
39/E02 |
| Gene synonyms/obsolete |
wak1; wis4; wik1 |
| Gene product |
mitogen-activated
protein kinase Wis4; MA serine/threonine protein kinase;
mitogen-activated protein kinase; MAP kinase kinase kinase
(MAPKKK); involved in the regulation of mitosis; Spc1 SAPK
cascade |
| Entry clone |
Cloned |
| ORF length (unspliced) |
4206 |
| ORF length (spliced) |
|
| Entry clone length |
4206 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
3769A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC9G1.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGGCTAGAGCATACTTT |
| Rev primer name |
SPAC9G1.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTCAACACTATAGTTTATT |
| Amino acid length |
1401 |
| Molecular weight |
160.5 |
| Isoelectric point (calc.) |
5.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKFYFKLLTL |
| Localization (YFP) |
cytosol; cytoplasmic
dots |
| Comments for localization |
aggregates by over
expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |