| Gene name |
SPAC2G11.02 |
| Gene ID |
39/D12 |
| Gene synonyms/obsolete |
|
| Gene product |
hypothetical protein
hypothetical protein; similar to Sp cut1 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
4015 |
| ORF length (spliced) |
3957 |
| Entry clone length |
4015 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
98A:G / 131T:C /
363T:C / 814T:C / 3887A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC2G11.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTTTACAAACGCTAAC |
| Rev primer name |
SPAC2G11.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGCTTCATTCCACTTAGCA |
| Amino acid length |
1318 |
| Molecular weight |
151.5 |
| Isoelectric point (calc.) |
7.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LHQTLGSILAL/LSSTVWSLQL/LLCYLEQCLRL/LADFRELPL/LTALSTILNL |
| Localization (YFP) |
cytosol |
| Comments for localization |
cytoplasmic dots by
over expression? |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |