| Gene name |
SPAP4C9.01c |
| Gene ID |
39/D10 |
| Gene synonyms/obsolete |
rad50;
SPAC1556.01c |
| Gene product |
putative DNA repair
protein, Rad50 homolog involved in DNA repair; SMC-like
protein; involved in meiotic recombination; nvolved in DNA
repair of lesion at the mating-type locus; nvolved in
processing of DNA breaks; interacts with the cohesin complex
during S phase to assist repair; stimulates sister chromatid
recombination; links cohesion with repair; functions in the
same pathway for the repair of MMS-induced damage as Rad21;
AAA family ATPase; CXXC motif involved in Zn2+-mediated
dimerization; predicted to bind Rad32p; Rad50 Zn hook |
| Entry clone |
Cloned |
| ORF length (unspliced) |
4002 |
| ORF length (spliced) |
3873 |
| Entry clone length |
4002 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
1042A:G / 1796A:G /
2420A:G / 3593A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAP4C9.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGTGCATTGACAGAAT |
| Rev primer name |
SPAP4C9.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGTTAGTACTATAACTGTG |
| Amino acid length |
1290 |
| Molecular weight |
149.5 |
| Isoelectric point (calc.) |
5.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LQGDLQGLDI/LACIIIRLAL |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Leica,
Confocal |