Chemical Genetics Laboratory
PREVIOUS  NEXT
Schizosaccharomyces pombe Postgenome Database

Gene name SPAP4C9.01c
Gene ID 39/D10
Gene synonyms/obsolete rad50; SPAC1556.01c
Gene product putative DNA repair protein, Rad50 homolog involved in DNA repair; SMC-like protein; involved in meiotic recombination; nvolved in DNA repair of lesion at the mating-type locus; nvolved in processing of DNA breaks; interacts with the cohesin complex during S phase to assist repair; stimulates sister chromatid recombination; links cohesion with repair; functions in the same pathway for the repair of MMS-induced damage as Rad21; AAA family ATPase; CXXC motif involved in Zn2+-mediated dimerization; predicted to bind Rad32p; Rad50 Zn hook
Entry clone Cloned
ORF length (unspliced) 4002
ORF length (spliced) 3873
Entry clone length 4002
No. of intron 3
Sequence status Finished
Sequence results 1042A:G / 1796A:G / 2420A:G / 3593A:G
Comments
Polymerase used for cloning Platinum Taq HiFi (Invitrogen)
Fwd primer name SPAP4C9.01.Fd
Fwd primer SEQ AAAAAGCAGGCTCTCATATGTCGTGCATTGACAGAAT
Rev primer name SPAP4C9.01.Rv
Rev primer SEQ AGAAAGCTGGGTAAGTTAGTACTATAACTGTG
Amino acid length 1290
Molecular weight 149.5
Isoelectric point (calc.) 5.9
Signal SEQ
No. of transmembrane domain
NLS position (Columbia Univ. Bioinformatics Center) none
NES motif ( L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) LQGDLQGLDI/LACIIIRLAL
Localization (YFP) no apparent signal
Comments for localization
Effect of LMB on protein localization not determined
Microscope used for observation Leica, Confocal

Image information
  No image data registered.

For plasmid request Click!
Copyright (c) RIKEN (The Institute of Physical and Chemical Research), Japan. All rights reserved.