| Gene name |
SPAC6F12.10c |
| Gene ID |
39/D08 |
| Gene synonyms/obsolete |
ade3; min11 |
| Gene product |
phosphoribosylformylglycinamidine synthase
phosphoribosylformylglycinamidine synthase; involved in purine
biosynthesis |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3972 |
| ORF length (spliced) |
|
| Entry clone length |
3972 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
1306A:G /
2751T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC6F12.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTGGTTTATTATGGTGG |
| Rev primer name |
SPAC6F12.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACCAACCCATTTTCTAGCA |
| Amino acid length |
1323 |
| Molecular weight |
144.8 |
| Isoelectric point (calc.) |
5.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
Golgi; cytoplasmic
dots |
| Comments for localization |
except nucleolus |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |