| Gene name |
SPAC11E3.01c |
| Gene ID |
39/D03 |
| Gene synonyms/obsolete |
SPAC2H10.03c |
| Gene product |
putative Snf2 family
helicase SNF2 family; helicase C-terminal domain; similar to
human Snf2p homolog; involved in transcriptional regulation;
chromodomain-helicase-binding protein |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3867 |
| ORF length (spliced) |
|
| Entry clone length |
3867 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
3121A:G /
3161A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC11E3.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTTACGAGGAGTCAGA |
| Rev primer name |
SPAC11E3.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACCATTCATCACTAGTTCCT |
| Amino acid length |
1288 |
| Molecular weight |
149.4 |
| Isoelectric point (calc.) |
6.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
397/183 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |