| Gene name |
SPAC6C3.06c |
| Gene ID |
39/B06 |
| Gene synonyms/obsolete |
|
| Gene product |
putative
cation-transporting ATPase P-type ATPase; P4 type;
aminophospholipid translocase |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3243 |
| ORF length (spliced) |
3102 |
| Entry clone length |
3243 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
1046T:C /
2533T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC6C3.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGACTCAAGACTAAATCG |
| Rev primer name |
SPAC6C3.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACGTTGCAGCTTTGCATAA |
| Amino acid length |
1033 |
| Molecular weight |
116.5 |
| Isoelectric point (calc.) |
7.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
10 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSQLIPPLKI/LCTFVLVLSI/LVRNLVLALSL/LNNNVYKILNI/LENDMDLLGL/LQKDVKITLEL/LISVYQGLII |
| Localization (YFP) |
Golgi |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |