| Gene name |
SPAC1071.10c |
| Gene ID |
39/A12 |
| Gene synonyms/obsolete |
pma1 |
| Gene product |
plasma membrane ATPase
1 (EC 3.6.1.35) P-type proton ATPase; P3 type |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2760 |
| ORF length (spliced) |
|
| Entry clone length |
2760 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
21A:G / 1806T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC1071.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTGATAACGCTGGTGA |
| Rev primer name |
SPAC1071.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGCATCACCCTTCTCATGG |
| Amino acid length |
919 |
| Molecular weight |
99.8 |
| Isoelectric point (calc.) |
4.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
9 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
411 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLVLVLLTL/LARLLEYTLAI/LSLHLEIFLGL/LSTVIGIVLAI |
| Localization (YFP) |
Golgi?; periphery; a
few cytoplasmic dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica,
DeltaVision |