| Gene name |
SPBC29A3.01 |
| Gene ID |
39/A07 |
| Gene synonyms/obsolete |
|
| Gene product |
heavy metal ATPase; P1
type; similar to S. cerevisiae YDR270W; disease
associated Menkes/Wilson disease; 8 predicted transmembrane
helices |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2715 |
| ORF length (spliced) |
|
| Entry clone length |
2715 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
1782A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC29A3.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTATACTACTACACTTTC |
| Rev primer name |
SPBC29A3.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGACTTCATTAGCCACTGGC |
| Amino acid length |
904 |
| Molecular weight |
97.8 |
| Isoelectric point (calc.) |
5.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
8 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSVLASSLLL |
| Localization (YFP) |
Golgi?; vacuole
membrane by over expression |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica,
DeltaVision |