| Gene name |
SPAC1039.05c |
| Gene ID |
38/G08 |
| Gene synonyms/obsolete |
|
| Gene product |
fungal conserved
protein; zinc finger protein; zf-C2H2 type; similar to Sp zas1
(paralog) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2651 |
| ORF length (spliced) |
2346 |
| Entry clone length |
2651 |
| No. of intron |
5 |
| Sequence status |
Finished |
| Sequence results |
106A:G / 693A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC1039.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACCAAGGCGAAAAAAAG |
| Rev primer name |
SPAC1039.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAGCTGTACTAATTTAGAC |
| Amino acid length |
781 |
| Molecular weight |
89 |
| Isoelectric point (calc.) |
7.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nuclear dots; nucleus;
spindle microtubules |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |