| Gene name |
SPAC1687.11 |
| Gene ID |
38/G06 |
| Gene synonyms/obsolete |
pmt2 |
| Gene product |
RNA methyltransferase;
potential SAM-dependent enzyme; involved in rRNA
processing |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2647 |
| ORF length (spliced) |
2409 |
| Entry clone length |
2647 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
345T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC1687.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGTAAATCACAAAAAAA |
| Rev primer name |
SPAC1687.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACGACGACCCTTTTTAGCT |
| Amino acid length |
802 |
| Molecular weight |
90.9 |
| Isoelectric point (calc.) |
6.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
SPB?; nucleus |
| Comments for localization |
bright nuclear dots by
over expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |