| Gene name |
SPCC1620.11 |
| Gene ID |
38/F01 |
| Gene synonyms/obsolete |
|
| Gene product |
nuclear pore complex;
similar to Sp SPCC1739.14 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2605 |
| ORF length (spliced) |
2556 |
| Entry clone length |
2605 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
99T:C / 1950T:C /
2286T:C / 2470C:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC1620.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACGGTTGCGTCTGACGA |
| Rev primer name |
SPCC1620.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGTCATTTCTATTTCGCAG |
| Amino acid length |
851 |
| Molecular weight |
97.5 |
| Isoelectric point (calc.) |
6.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSSLQQLEI |
| Localization (YFP) |
cytosol; nuclear
envelope |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |