Gene name |
SPCC5E4.03c |
Gene ID |
38/B09 |
Gene synonyms/obsolete |
taf72 |
Gene product |
transcription
initiation factor TFIID subunit; TAF(II) complex
(TBP-associated protein complex); SAGA complex; involved in
establishment and/or maintenance of chromatin architecture;
involved in transcriptional activation; essential;
overexpression suppresses the anaphase blocking mutation cut9;
possible role of WD repeat-containing TAFs in the expression
of genes involved in progression through the M phase of the
cell cycle; WD repeat protein (5) |
Entry clone |
Cloned |
ORF length (unspliced) |
2300 |
ORF length (spliced) |
1932 |
Entry clone length |
2300 |
No. of intron |
4 |
Sequence status |
Finished |
Sequence results |
71G:A / 93G:A |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC5E4.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTGCCACTAATGGGCC |
Rev primer name |
SPCC5E4.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAACTAACGCTTATTGCTAAG |
Amino acid length |
643 |
Molecular weight |
72.3 |
Isoelectric point (calc.) |
6.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRDWVDSSLEL |
Localization (YFP) |
cytosol=nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |