Gene name |
SPAC7D4.12c |
Gene ID |
38/B05 |
Gene synonyms/obsolete |
|
Gene product |
hypothetical protein;
Sc YJL108C is regulated by pheromone; similar to Sp
SPAC7D4.12c |
Entry clone |
Cloned |
ORF length (unspliced) |
2280 |
ORF length (spliced) |
|
Entry clone length |
2280 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
305A:G / 370A:G /
1452A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC7D4.12.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGACGGAAATCGTAGAGT |
Rev primer name |
SPAC7D4.12.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAAACTAAATAAGCCAGAT |
Amino acid length |
759 |
Molecular weight |
83.3 |
Isoelectric point (calc.) |
8.4 |
Signal SEQ |
|
No. of transmembrane domain |
9 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFVPLFTLCL |
Localization (YFP) |
ER |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |