Gene name |
SPBC1289.10c |
Gene ID |
38/B02 |
Gene synonyms/obsolete |
|
Gene product |
transcriptional
regulator; similar to N. crassa Som1; similar to Sp SPCC70.01;
LisH domain (SMART); single-stranded DNA binding protein
(SSDP) (inferred from context) |
Entry clone |
Cloned |
ORF length (unspliced) |
2232 |
ORF length (spliced) |
|
Entry clone length |
2232 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
360T:C / 2182T:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC1289.10.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTGATCCAGGTTTAAG |
Rev primer name |
SPBC1289.10.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGCAGCAGTCGAGTCTTCA |
Amino acid length |
743 |
Molecular weight |
81.1 |
Isoelectric point (calc.) |
7.2 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKNYMEELKL |
Localization (YFP) |
cytoplasmic dots
|
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |