| Gene name |
SPAC1952.13 |
| Gene ID |
37/H03 |
| Gene synonyms/obsolete |
ned1 |
| Gene product |
nuclear elongation and
deformation protein; required for chromosome stability;
required for normal nuclear morphology; conserved eukaryotic
protein; functional homolog of Sc SMP2; homolog of mouse lpin;
interacts physically with Pim1p (2-hybrid); interacts
physically with Dis3p (2-hybrid); interacts physically with
Nup189p (2-hybrid); interacts genetically with pim1; interacts
genetically with spi1; interacts genetically with dis1;
interacts genetically with dis2; interacts genetically with
dis3; interacts genetically with crm1 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2189 |
| ORF length (spliced) |
1971 |
| Entry clone length |
2189 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
1492T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC1952.13.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCAATATGTAGGACGAGC |
| Rev primer name |
SPAC1952.13.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAACAGCATTTTCAACGTCT |
| Amino acid length |
656 |
| Molecular weight |
73.3 |
| Isoelectric point (calc.) |
4.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |