| Gene name |
SPCC1902.01 |
| Gene ID |
37/H01 |
| Gene synonyms/obsolete |
gaf1;
SPCC417.01c |
| Gene product |
ranSpription factor;
involved in transcriptional activation; zinc finger protein;
zf-GATA type |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2568 |
| ORF length (spliced) |
|
| Entry clone length |
2568 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
609T:G / 1682T:C /
2266C:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC1902.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATCTAAAGTTTTCCAA |
| Rev primer name |
SPCC1902.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACATAACGCTATACCAATCC |
| Amino acid length |
855 |
| Molecular weight |
91.7 |
| Isoelectric point (calc.) |
7.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol; cytoplasmic
dots at site of septum formation |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to: nucleus
(intranuclear microtubule bundle?) |
| Microscope used for
observation |
Leica |